Review



pcs2 rab11 mcherry plasmid  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs pcs2 rab11 mcherry plasmid
    Pcs2 Rab11 Mcherry Plasmid, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 5716 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcs2+rab11+mcherry+plasmid/Q5+Site-Directed+Mutagenesis+Kit/pm37289834-285-12-10
    Average 99 stars, based on 5716 article reviews
    pcs2 rab11 mcherry plasmid - by Bioz Stars, 2026-10
    99/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Yolk granule fusion and microtubule aster formation regulate cortical granule translocation and exocytosis in zebrafish oocytes.
    Article Snippet: Injections into PLOS Biology | https://doi.org/10.1371/journal.pbio.3002146 June 8, 2023 18 / 35 stage III oocytes were performed as described in [53] using glass capillary needles (30–0020, Harvard Apparatus, MA, USA), which were pulled by a needle puller (P-97, Sutter Instrument) and attached to a microinjection system (PV820, World Precision Instruments). .. The PCS2-Rab11S25N-mCherry plasmid was generated using Q5 Site-Directed Mutagenesis Kit (NEB) with PCS2-Rab11-mCherry plasmid and Rab11S25N-mCherry-Fwd (TGTGGGGAAG aatAACCTGCTGT) and Rab11S25N-mCherry-Rev (CCAGAGTCTCCAATTAGGACC) primers. .. The PCS2-DCLK-mKO2 plasmid was constructed by amplifying the coding sequences of DCLK1a-202-deltaK (from pT2KXIG-Xef1a-DCLK-GFP, ZFIN ID: ZDB-TGCONSTRCT090702-3) and mKO2 (from mKOkappa-2A-mTurquoise2, Addgene plasmid # 98837) using gene-specific primers with overlapping arms DCLK1a-202_FOR (TGCAGGATCCCATATG GAGGAGCATTTTGACGA), DCLK1a-202_REV (taatcacactCCGATCTGAAATGGA GCTC), mKO2_FOR (TCAGATCGGagtgtgattaaaccagagatgaagatga), and mKO2_REV (TCACTATAGTTCTAGAGGCggaatgagctactgcatcttcta) and then cloned into ClaI-HF (NEB) and XhoI-HF (NEB) digested pCS2 plasmid (Lawson #444) with NEBuilder HiFi DNA Assembly Master Mix (NEB).

    Article Title: Yolk granule fusion and microtubule aster formation regulate cortical granule translocation and exocytosis in zebrafish oocytes
    Article Snippet: Injections into stage-III oocytes were performed as described in ( ) using glass capillary needles (30-0020, Harvard Apparatus, MA, USA), which were pulled by a needle puller (P-97, Sutter Instrument) and attached to a microinjection system (PV820, World Precision Instruments). .. The PCS2-Rab11S25N-mCherry plasmid was generated using Q5 Site-Directed Mutagenesis Kit (NEB) with PCS2-Rab11-mCherry plasmid and Rab11S25N-mCherry-Fwd (TGTGGGGAAGaatAACCTGCTGT) and Rab11S25N-mCherry-Rev (CCAGAGTCTCCAATTAGGACC) primers. .. The PCS2-DCLK-mKO2 plasmid was constructed by amplifying the coding sequences of DCLK1a-202-deltaK (from pT2KXIG-Xef1a-DCLK-GFP, ZFIN ID: ZDB-TGCONSTRCT-090702-3) and mKO2 (from mKOkappa-2A-mTurquoise2, Addgene plasmid # 98837) using gene specific primers with overlapping arms DCLK1a-202_FOR (TGCAGGATCCCATATGGAGGAGCATTTTGACGA), DCLK1a-202_REV (taatcacactCCGATCTGAAATGGAGCTC), mKO2_FOR (TCAGATCGGagtgtgattaaaccagagatgaagatga) and mKO2_REV (TCACTATAGTTCTAGAGGCggaatgagctactgcatcttcta) and then cloned into ClaI-HF (NEB) and XhoI-HF (NEB) digested pCS2 plasmid (Lawson #444) with NEBuilder HiFi DNA Assembly Master Mix (NEB).

    Article Title: Yolk granule fusion and microtubule aster formation regulate cortical granule translocation and exocytosis in zebrafish oocytes
    Article Snippet: Injections into stage III oocytes were performed as described in [ ] using glass capillary needles (30–0020, Harvard Apparatus, MA, USA), which were pulled by a needle puller (P-97, Sutter Instrument) and attached to a microinjection system (PV820, World Precision Instruments). .. The PCS2-Rab11S25N-mCherry plasmid was generated using Q5 Site-Directed Mutagenesis Kit (NEB) with PCS2-Rab11-mCherry plasmid and Rab11S25N-mCherry-Fwd (TGTGGGGAAGaatAACCTGCTGT) and Rab11S25N-mCherry-Rev (CCAGAGTCTCCAATTAGGACC) primers. .. The PCS2-DCLK-mKO2 plasmid was constructed by amplifying the coding sequences of DCLK1a-202-deltaK (from pT2KXIG-Xef1a-DCLK-GFP , ZFIN ID: ZDB-TGCONSTRCT-090702-3) and mKO2 (from mKOkappa-2A-mTurquoise2 , Addgene plasmid # 98837) using gene-specific primers with overlapping arms DCLK1a-202_FOR (TGCAGGATCCCATATGGAGGAGCATTTTGACGA), DCLK1a-202_REV (taatcacactCCGATCTGAAATGGAGCTC), mKO2_FOR (TCAGATCGGagtgtgattaaaccagagatgaagatga), and mKO2_REV (TCACTATAGTTCTAGAGGCggaatgagctactgcatcttcta) and then cloned into ClaI-HF (NEB) and XhoI-HF (NEB) digested pCS2 plasmid (Lawson #444) with NEBuilder HiFi DNA Assembly Master Mix (NEB).

    Generated:

    Article Title: Yolk granule fusion and microtubule aster formation regulate cortical granule translocation and exocytosis in zebrafish oocytes.
    Article Snippet: Injections into PLOS Biology | https://doi.org/10.1371/journal.pbio.3002146 June 8, 2023 18 / 35 stage III oocytes were performed as described in [53] using glass capillary needles (30–0020, Harvard Apparatus, MA, USA), which were pulled by a needle puller (P-97, Sutter Instrument) and attached to a microinjection system (PV820, World Precision Instruments). .. The PCS2-Rab11S25N-mCherry plasmid was generated using Q5 Site-Directed Mutagenesis Kit (NEB) with PCS2-Rab11-mCherry plasmid and Rab11S25N-mCherry-Fwd (TGTGGGGAAG aatAACCTGCTGT) and Rab11S25N-mCherry-Rev (CCAGAGTCTCCAATTAGGACC) primers. .. The PCS2-DCLK-mKO2 plasmid was constructed by amplifying the coding sequences of DCLK1a-202-deltaK (from pT2KXIG-Xef1a-DCLK-GFP, ZFIN ID: ZDB-TGCONSTRCT090702-3) and mKO2 (from mKOkappa-2A-mTurquoise2, Addgene plasmid # 98837) using gene-specific primers with overlapping arms DCLK1a-202_FOR (TGCAGGATCCCATATG GAGGAGCATTTTGACGA), DCLK1a-202_REV (taatcacactCCGATCTGAAATGGA GCTC), mKO2_FOR (TCAGATCGGagtgtgattaaaccagagatgaagatga), and mKO2_REV (TCACTATAGTTCTAGAGGCggaatgagctactgcatcttcta) and then cloned into ClaI-HF (NEB) and XhoI-HF (NEB) digested pCS2 plasmid (Lawson #444) with NEBuilder HiFi DNA Assembly Master Mix (NEB).

    Article Title: Yolk granule fusion and microtubule aster formation regulate cortical granule translocation and exocytosis in zebrafish oocytes
    Article Snippet: Injections into stage-III oocytes were performed as described in ( ) using glass capillary needles (30-0020, Harvard Apparatus, MA, USA), which were pulled by a needle puller (P-97, Sutter Instrument) and attached to a microinjection system (PV820, World Precision Instruments). .. The PCS2-Rab11S25N-mCherry plasmid was generated using Q5 Site-Directed Mutagenesis Kit (NEB) with PCS2-Rab11-mCherry plasmid and Rab11S25N-mCherry-Fwd (TGTGGGGAAGaatAACCTGCTGT) and Rab11S25N-mCherry-Rev (CCAGAGTCTCCAATTAGGACC) primers. .. The PCS2-DCLK-mKO2 plasmid was constructed by amplifying the coding sequences of DCLK1a-202-deltaK (from pT2KXIG-Xef1a-DCLK-GFP, ZFIN ID: ZDB-TGCONSTRCT-090702-3) and mKO2 (from mKOkappa-2A-mTurquoise2, Addgene plasmid # 98837) using gene specific primers with overlapping arms DCLK1a-202_FOR (TGCAGGATCCCATATGGAGGAGCATTTTGACGA), DCLK1a-202_REV (taatcacactCCGATCTGAAATGGAGCTC), mKO2_FOR (TCAGATCGGagtgtgattaaaccagagatgaagatga) and mKO2_REV (TCACTATAGTTCTAGAGGCggaatgagctactgcatcttcta) and then cloned into ClaI-HF (NEB) and XhoI-HF (NEB) digested pCS2 plasmid (Lawson #444) with NEBuilder HiFi DNA Assembly Master Mix (NEB).

    Article Title: Yolk granule fusion and microtubule aster formation regulate cortical granule translocation and exocytosis in zebrafish oocytes
    Article Snippet: Injections into stage III oocytes were performed as described in [ ] using glass capillary needles (30–0020, Harvard Apparatus, MA, USA), which were pulled by a needle puller (P-97, Sutter Instrument) and attached to a microinjection system (PV820, World Precision Instruments). .. The PCS2-Rab11S25N-mCherry plasmid was generated using Q5 Site-Directed Mutagenesis Kit (NEB) with PCS2-Rab11-mCherry plasmid and Rab11S25N-mCherry-Fwd (TGTGGGGAAGaatAACCTGCTGT) and Rab11S25N-mCherry-Rev (CCAGAGTCTCCAATTAGGACC) primers. .. The PCS2-DCLK-mKO2 plasmid was constructed by amplifying the coding sequences of DCLK1a-202-deltaK (from pT2KXIG-Xef1a-DCLK-GFP , ZFIN ID: ZDB-TGCONSTRCT-090702-3) and mKO2 (from mKOkappa-2A-mTurquoise2 , Addgene plasmid # 98837) using gene-specific primers with overlapping arms DCLK1a-202_FOR (TGCAGGATCCCATATGGAGGAGCATTTTGACGA), DCLK1a-202_REV (taatcacactCCGATCTGAAATGGAGCTC), mKO2_FOR (TCAGATCGGagtgtgattaaaccagagatgaagatga), and mKO2_REV (TCACTATAGTTCTAGAGGCggaatgagctactgcatcttcta) and then cloned into ClaI-HF (NEB) and XhoI-HF (NEB) digested pCS2 plasmid (Lawson #444) with NEBuilder HiFi DNA Assembly Master Mix (NEB).

    Mutagenesis:

    Article Title: Yolk granule fusion and microtubule aster formation regulate cortical granule translocation and exocytosis in zebrafish oocytes.
    Article Snippet: Injections into PLOS Biology | https://doi.org/10.1371/journal.pbio.3002146 June 8, 2023 18 / 35 stage III oocytes were performed as described in [53] using glass capillary needles (30–0020, Harvard Apparatus, MA, USA), which were pulled by a needle puller (P-97, Sutter Instrument) and attached to a microinjection system (PV820, World Precision Instruments). .. The PCS2-Rab11S25N-mCherry plasmid was generated using Q5 Site-Directed Mutagenesis Kit (NEB) with PCS2-Rab11-mCherry plasmid and Rab11S25N-mCherry-Fwd (TGTGGGGAAG aatAACCTGCTGT) and Rab11S25N-mCherry-Rev (CCAGAGTCTCCAATTAGGACC) primers. .. The PCS2-DCLK-mKO2 plasmid was constructed by amplifying the coding sequences of DCLK1a-202-deltaK (from pT2KXIG-Xef1a-DCLK-GFP, ZFIN ID: ZDB-TGCONSTRCT090702-3) and mKO2 (from mKOkappa-2A-mTurquoise2, Addgene plasmid # 98837) using gene-specific primers with overlapping arms DCLK1a-202_FOR (TGCAGGATCCCATATG GAGGAGCATTTTGACGA), DCLK1a-202_REV (taatcacactCCGATCTGAAATGGA GCTC), mKO2_FOR (TCAGATCGGagtgtgattaaaccagagatgaagatga), and mKO2_REV (TCACTATAGTTCTAGAGGCggaatgagctactgcatcttcta) and then cloned into ClaI-HF (NEB) and XhoI-HF (NEB) digested pCS2 plasmid (Lawson #444) with NEBuilder HiFi DNA Assembly Master Mix (NEB).

    Article Title: Yolk granule fusion and microtubule aster formation regulate cortical granule translocation and exocytosis in zebrafish oocytes
    Article Snippet: Injections into stage-III oocytes were performed as described in ( ) using glass capillary needles (30-0020, Harvard Apparatus, MA, USA), which were pulled by a needle puller (P-97, Sutter Instrument) and attached to a microinjection system (PV820, World Precision Instruments). .. The PCS2-Rab11S25N-mCherry plasmid was generated using Q5 Site-Directed Mutagenesis Kit (NEB) with PCS2-Rab11-mCherry plasmid and Rab11S25N-mCherry-Fwd (TGTGGGGAAGaatAACCTGCTGT) and Rab11S25N-mCherry-Rev (CCAGAGTCTCCAATTAGGACC) primers. .. The PCS2-DCLK-mKO2 plasmid was constructed by amplifying the coding sequences of DCLK1a-202-deltaK (from pT2KXIG-Xef1a-DCLK-GFP, ZFIN ID: ZDB-TGCONSTRCT-090702-3) and mKO2 (from mKOkappa-2A-mTurquoise2, Addgene plasmid # 98837) using gene specific primers with overlapping arms DCLK1a-202_FOR (TGCAGGATCCCATATGGAGGAGCATTTTGACGA), DCLK1a-202_REV (taatcacactCCGATCTGAAATGGAGCTC), mKO2_FOR (TCAGATCGGagtgtgattaaaccagagatgaagatga) and mKO2_REV (TCACTATAGTTCTAGAGGCggaatgagctactgcatcttcta) and then cloned into ClaI-HF (NEB) and XhoI-HF (NEB) digested pCS2 plasmid (Lawson #444) with NEBuilder HiFi DNA Assembly Master Mix (NEB).

    Article Title: Yolk granule fusion and microtubule aster formation regulate cortical granule translocation and exocytosis in zebrafish oocytes
    Article Snippet: Injections into stage III oocytes were performed as described in [ ] using glass capillary needles (30–0020, Harvard Apparatus, MA, USA), which were pulled by a needle puller (P-97, Sutter Instrument) and attached to a microinjection system (PV820, World Precision Instruments). .. The PCS2-Rab11S25N-mCherry plasmid was generated using Q5 Site-Directed Mutagenesis Kit (NEB) with PCS2-Rab11-mCherry plasmid and Rab11S25N-mCherry-Fwd (TGTGGGGAAGaatAACCTGCTGT) and Rab11S25N-mCherry-Rev (CCAGAGTCTCCAATTAGGACC) primers. .. The PCS2-DCLK-mKO2 plasmid was constructed by amplifying the coding sequences of DCLK1a-202-deltaK (from pT2KXIG-Xef1a-DCLK-GFP , ZFIN ID: ZDB-TGCONSTRCT-090702-3) and mKO2 (from mKOkappa-2A-mTurquoise2 , Addgene plasmid # 98837) using gene-specific primers with overlapping arms DCLK1a-202_FOR (TGCAGGATCCCATATGGAGGAGCATTTTGACGA), DCLK1a-202_REV (taatcacactCCGATCTGAAATGGAGCTC), mKO2_FOR (TCAGATCGGagtgtgattaaaccagagatgaagatga), and mKO2_REV (TCACTATAGTTCTAGAGGCggaatgagctactgcatcttcta) and then cloned into ClaI-HF (NEB) and XhoI-HF (NEB) digested pCS2 plasmid (Lawson #444) with NEBuilder HiFi DNA Assembly Master Mix (NEB).



    Similar Products

    99
    New England Biolabs pcs2 rab11 mcherry plasmid
    Pcs2 Rab11 Mcherry Plasmid, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcs2+rab11+mcherry+plasmid/Q5+Site-Directed+Mutagenesis+Kit/pm37289834-285-12-10
    Average 99 stars, based on 1 article reviews
    pcs2 rab11 mcherry plasmid - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    88
    Addgene inc rab11 mcherry
    Rab11 Mcherry, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcs2+rab11+mcherry+plasmid/pCS2-CIB1-mCherry-Rab11+(Plasmid+%23140573)/pm32674302-94-8-11
    Average 88 stars, based on 1 article reviews
    rab11 mcherry - by Bioz Stars, 2026-10
    88/100 stars
      Buy from Supplier

    Image Search Results